Review



odyssey infrared laser fluorescence scanner  (LI-COR)


Bioz Verified Symbol LI-COR is a verified supplier
Bioz Manufacturer Symbol LI-COR manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    LI-COR odyssey infrared laser fluorescence scanner
    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular <t>fluorescence</t> complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.
    Odyssey Infrared Laser Fluorescence Scanner, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 25057 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/odyssey+infrared+laser+fluorescence+scanner/Odyssey+Classic+Imaging+System/pmc13034653-490-16-21
    Average 99 stars, based on 25057 article reviews
    odyssey infrared laser fluorescence scanner - by Bioz Stars, 2026-11
    99/100 stars

    Images

    1) Product Images from "A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry"

    Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry

    Journal: Cell reports

    doi: 10.1016/j.celrep.2025.116903

    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular fluorescence complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.
    Figure Legend Snippet: (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular fluorescence complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.

    Techniques Used: Bimolecular Fluorescence Complementation Assay, Fluorescence, Shear, Expressing, Control, Flow Cytometry

    Related Articles

    other:

    Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry.
    Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.

    Fluorescence:

    Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry
    Article Snippet: Static and sheared cells were collected at a density of 2 million cells/mL, spun at 300 g × 3 mins, and lysed in 350μL RLT buffer from RNeasy Mini Kit (74104, Qiagen). .. Co-detection was performed using IRDye 700 and 800-labeled secondary antibodies (926–68070 and 926–32211, Li-Cor) under the Odyssey infrared laser fluorescence scanner (Li-Cor) and quantified using ImageJ. .. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (4368814, Thermo Fisher).



    Similar Products

    odyssey infrared laser fluorescence scanner  (LI-COR)
    99
    LI-COR odyssey infrared laser fluorescence scanner
    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular <t>fluorescence</t> complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.
    Odyssey Infrared Laser Fluorescence Scanner, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/odyssey+infrared+laser+fluorescence+scanner/Odyssey+Classic+Imaging+System/pmc13034653-490-16-21
    Average 99 stars, based on 1 article reviews
    odyssey infrared laser fluorescence scanner - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    infrared fluorescence laser scanner  (LI-COR)
    99
    LI-COR infrared fluorescence laser scanner
    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular <t>fluorescence</t> complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.
    Infrared Fluorescence Laser Scanner, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/odyssey+infrared+laser+fluorescence+scanner/Odyssey+Classic+Imaging+System/pm34366893-85-7-13
    Average 99 stars, based on 1 article reviews
    infrared fluorescence laser scanner - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    odyssey infrared fluorescent dual laser scanner  (LI-COR)
    86
    LI-COR odyssey infrared fluorescent dual laser scanner
    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular <t>fluorescence</t> complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.
    Odyssey Infrared Fluorescent Dual Laser Scanner, supplied by LI-COR, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/odyssey+infrared+laser+fluorescence+scanner/pmc03200446-63-20-26
    Average 86 stars, based on 1 article reviews
    odyssey infrared fluorescent dual laser scanner - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular fluorescence complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.

    Journal: Cell reports

    Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry

    doi: 10.1016/j.celrep.2025.116903

    Figure Lengend Snippet: (A) Schematic of the STIM1/ORAI1 complex using split Venus as a yellow signal reporter in a bimolecular fluorescence complementation (BiFC) assay. Yellow fluorescence indicates STIM1/ORAI1 interaction. The signal is higher after shear stress compared to the static condition in THP-1 cells. (B) Quantification of the Venus-positive BiFC STIM1/ORAI1 THP-1 cells under shear stress and static conditions. The shear stress condition shows 10.60%-±0.70% Venus-positive cells, while the static condition only has 1.80% ±0.20% Venus-positive cells. (C) STIM1-KD and ORAI1-KD cells have decreased shear stress-mediated IL8 expression as compared to control THP-1 cells, as quantified by qPCR. Replicates, n = 6. (D) SPTAN1-KD and RAF1-KD cells have decreased STIM1 and ORAI1 interaction under shear stress condition based on decreased split Venus STIM1 and ORAI1 signal. Replicates, n = 6. (E) Quantification of flow cytometry data, showing that STIM1-KD and ORAI1-KD cells have decreased shear-mediated cellular necrosis and increased cell survival. Replicates, n = 6. (F) Proposed mode of the cascade molecular reaction induced by shear stress. (G) FR180204 , an ERK inhibitor, decreased shear stress-mediated IL8 expression in CD14 + primary monocytes. (H) Quantification of flow cytometry data, displaying a decrease in shear stress-mediated necrotic cells following treatment with FR180204 in CD14 + primary monocytes.

    Article Snippet: Co-detection was performed using IRDye 700 and 800-labeled secondary antibodies (926–68070 and 926–32211, Li-Cor) under the Odyssey infrared laser fluorescence scanner (Li-Cor) and quantified using ImageJ.

    Techniques: Bimolecular Fluorescence Complementation Assay, Fluorescence, Shear, Expressing, Control, Flow Cytometry